WarCry > Profiles > Olas
Not OnlineMaleUnited StatesPublisher's Club Member
Olas
Nicholas
Member Since: 24 Dec 2011
Last Active: Aug 28, 2016 21:10
General Details
Real Name:
Nicholas 
Location:
Right behind you. 
Birthdate:
August 7, 1992 
Occupation:
Tech Guy 
Motto:
Anyone can become angry - that is easy, But to be angry with the right person at the right time, and for the right purpose and in the right way - that is not within everyone's power and that is not easy. 
Interests:
Gaming (obviously), the outdoors, astronomy, music, digital art and media, politics, Film, to be honest it would be easier to name the things I'm not interested in. 
Bio:
The first 2048 digits of my genetic sequence: AUACAUUGAUGCCUCAGGAUGACGGAGCUUCGGAGCUAGGACCGAAUACGCCCCGCAUAAGCCAGGAUCGAGGCUUCGAGGCAGUAGGACUCCGUAGUUACAUAUUCCGUACAGUAUUUCGAAUCGUCAUACUAAGCUUUAUGACAUGCCUUAUACAUUGAUGCCUCAGGAUGACGGAGCUUCGGAGCUAGGACCGAAUACGCCCCGCA 
Gaming
Steam:
Cenk Uygur (0.0) 
Recommended Games
Hellgate
categories: fantasy